| Sign In to gain access to subscriptions and/or personal tools. |
Early Stellate Cell Activation and Veno-occlusive-disease (VOD)–like Hepatotoxicity in Dogs Treated with AR-H047108, an Imidazopyridine Proton Pump Inhibitor
1 AstraZeneca R&D Södertälje, Södertälje, Sweden Correspondence: Anna-Lena Berg, Safety Assessment, Pathology, B681, AstraZeneca R&D Södertälje, S-151 85 Södertälje, Sweden; e-mail:anna-lena.berg{at}astrazeneca.com.
Dogs treated with AR-H047108, an imidazopyridine potassium competitive acid blocker (P-CAB), developed clinical signs of hepatic dysfunction as well as morphologically manifest hepatotoxicity in repeat-dose toxicity studies. An investigative one-month study was performed, with interim euthanasia after one and two weeks. A detailed histopathological and immunohistochemical characterization of the liver lesions was conducted, including markers for fibrosis, Kupffer cell activation, apoptosis, and endothelial injury. In addition, hepatic retinoid and procollagen 1  2 mRNA levels in livers of dogs treated with AR-H047108 were analyzed. The results showed an early inflammatory process in central veins and centrilobular areas, present after one week of treatment. This inflammatory reaction was paralleled by activation of stellate/Ito cells to myofibroblasts and was associated with sinusoidal and centrivenular fibrosis. The early activation of stellate cells coincided with a significant decrease in retinyl ester levels, and a significant increase in procollagen 12 mRNA levels, in the liver. At later time points (three and six months), there was marked sinusoidal fibrosis in centrilobular areas, as well as occlusion of central veins resulting from a combination of fibrosis and increased thickness of smooth muscle bundles in the vessel wall. The pattern of lesions suggests a veno-occlusive-disease (VOD)–like scenario, possibly linked to the imidazopyridine chemical structure of the compound facilitated by specific morphological features of the dog liver.
Key Words: veno-occlusive disease • VOD • hepatotoxicity • imidazopyridine • stellate cells • fibrosis Abbreviations: ABC, avidin-biotin complex • ALP, alkaline phosphatase • ALT, alanine aminotransferase • AST, aspartate aminotransferase • APTT, activated partial thromboplastin time • AUC, area under the curve • DAB, diaminobenzidine • ET-1, endothelin-1 • H&E, hematoxylin and eosin • MT, Masson-Trichrome • PBR, peripheral benzodiazepine receptor • P-CABs, potassium competitive acid blockers • RNA, ribonucleic acid • SECs, sinusoidal endothelial cells • SMA, smooth muscle actin • TGFβ, transforming growth factor beta • TUNEL, TdT-mediated dUTP nick-end labeling • VOD, veno-occlusive disease
Several proton pump inhibitors for treatment of gastroesophageal reflux disease and other acid-related diseases have been developed since the 1970s. Omeprazole was the first proton pump inhibitor used in clinical practice. Omeprazole acts through specific inhibition of the gastric H+K+-ATPase located in the apical membrane of the parietal cell in the gastric mucosa. Since this enzyme represents the final step of acid secretion, inhibition of it reduces acid secretion regardless of how secretion is stimulated (Olbe et al. 2003). Esomeprazole is the S-isomer of omeprazole and has an identical mechanism of action, although its bioavailability is higher. Both omeprazole and esomeprazole belong chemically to the substituted benzimidazole class. A second-generation class of proton pump inhibitors with a different mode of action, the so-called potassium competitive acid blockers (P-CABs), was developed as follow-up compounds to omeprazole and esomeprazole. The P-CABs act through a reversible, K+-competitive inhibition of the H+K+-ATPase in the parietal cells. They give a faster onset of gastric acid inhibition, and in contrast to omeprazole and esomeprazole, the effect is directly correlated to the plasma concentration (Andersson and Carlsson 2005). Although the P-CABs have shown excellent pharmacological results in both animal studies and in humans, a recurring problem with a few of these drug candidates has been a specific hepatotoxicity restricted to dogs. In rats, none of the compounds has caused any liver changes apart from centrilobular hepatocytic hypertrophy associated with induction of cytochrome P450 enzymes. Monkeys have shown no liver effects whatsoever.
We here report on the histopathological and molecular characterization of drug-induced liver lesions in dogs treated with the imidazopyridine P-CAB AR-H047108, using a wide range of immunohistochemical markers as well as analysis of hepatic retinoid and procollagen 1
Test Substance AR-H047108 (8-[(2-ethyl-6-methylbenzyl)amino]-2,3-dimethylimidazo[1,2-a]pyridine-6-carboxamide) was synthesized by AstraZeneca. The test substance was supplied as tablets packed in gelatin capsules. The chemical structure of AR-H047108 is shown in Figure 1.
Animals Male and female beagle dogs from two different breeders were used in three studies: two toxicity studies (three months with a three-month recovery period and six-month duration, respectively) and one investigative study (one month). The dogs were acclimatized to laboratory conditions for at least one month before study start. Each animal received 200–350 g once daily of a dog laboratory diet (Specific CXD, Lövens Kemiske Fabrik, Denmark). Municipal tap water for human consumption was available at all times via an automatic watering system. Approximately twenty-four hours after the last dose, the animals were terminated. Approval from the animal research ethics committee had been obtained for using these animals in preclinical safety studies.
Three- and Six-month Toxicity Studies In the three-month study, three males and three females, aged 5.5–8.5 months at the start of the study, were included at each dose level. The dose levels were 20, 80, and 320 µmol/kg (6.73, 26.9, or 108 mg/kg, expressed as the base form AR-H047108). After two months of dosing, the high dose was reduced to 240 µmol/kg (81 mg/kg base form) because of low food consumption and affected general condition among dogs at this exposure level. Recovery dogs (three months without dosing) were included for assessment. In the six-month study, five males and five females, aged 7.5–8.5 months at the start of the study, were included at each dose level. The dose levels were 20, 70, and 249 µmol/kg (6.7, 24, or 81 mg/kg base form). After three and a half months, the high dose was reduced to 180 µmol/kg (61 mg/kg base form) because of low food consumption and affected general condition among dogs at this exposure level. To maintain a sufficient separation in the exposure levels, the intermediate group was reduced to 60 µmol/kg (20 mg/kg as free base). Clinical signs were recorded daily. Body weight was recorded before dosing started, and then once weekly during the study. Individual food consumption was recorded daily. Blood sampling for determination of the concentration of AR-H047108 and its pharmacologically active metabolite AR-H047116 in plasma was performed on all animals. Blood samples for hematology and clinical chemistry analyses were obtained before dosing started and after one, three, and six months of dosing, and after one and three months of recovery. All main-study dogs were subjected to necropsy. A full range of tissues from all dogs was evaluated microscopically on hematoxylin and eosin (H&E)-stained slides. Liver sections were also stained with Masson-Trichrome (MT) and Oil Red. Immunohistochemistry was performed on liver sections using a panel of markers covering various aspects of liver pathology (see below under Histopathology and Immunohistochemistry).
One-month Investigative Study
Histopathology and Immunohistochemistry
Immunohistochemical staining was in most cases performed using the Dakocytomation Techmate 500+, TMS20288. Some stainings were performed using the Ventana Discovery XT automated slide-processing system, according to the manufacturer’s instruction. The avidin-biotin complex (ABC) was used as detection system, with diaminobenzidine (DAB) as the chromogen. The staining of canine IgG was performed manually with an alkaline phosphatase-conjugated rabbit F(ab)2, using Fast Red as the chromogen. To further characterize transforming growth factor beta (TGFβ)-positive cells, double staining with TGFβ and tryptase was performed. After immunostaining, the slides were counterstained in hematoxylin and mounted with Pertex (except the Fast Red-stained slides, which were mounted in aqueous mounting medium).
Detection of Apoptotic Cells
Evaluation of Immunohistochemical Stainings
Levels of Apolar Retinoids in Liver Samples
Procollagen 1 Total RNA was prepared with the QIAGEN RNeasy Midi Prep Kit. The frozen tissue samples were transferred to Lysing MatrixD tubes (BI0101, cat. no. 6913-100) containing 1 mL RLT buffer (1 mL lysis buffer + 10 µ1 14,3M β-ME) and homogenized in the Fastprep FP120 instrument (BIO 101, SAVANT, cat. no. 6000-120). Liver samples were homogenized three times for ten seconds at level 6 and chilled on ice in between. The homogenates were transferred to Qiashredder tubes (QIAGEN, cat. no. 79656) and centrifuged at 8000 rpm (6800xg) for three minutes in an Eppendorf microcentrifuge. The eluates were mixed with 1 mL EtOH and vortexed for five seconds. The eluates were then immediately transferred to an RNeasy midi spin column, and total RNA preparation was performed according to the manual provided with the RNeasy Midi Kit (QIAGEN, cat. no. 75144). The total RNA was eluted in 2x100 µL DEPC water and subsequently quantified using the Agilent 2100 Bioanalyzer and the RNA 6000 Nano Kit (Agilent Cat. no. 5065-4476). The procedure was performed according to the manufacturer’s manual (Reagent Kit Guide, RNA 6000 Nano Assay, Edition 07/01). After quantification, the total RNA was stored at –70°C. DNase1 treatment was performed using RQ1 RNase-Free DNase from Promega (cat. no. M6101). The reaction was incubated at 37°C for thirty minutes, and then RQ1 DNase Stop Solution was added to terminate the reaction. The samples were incubated at 65°C for ten minutes to inactivate the DNase. This reaction was divided in two samples, and the cDNA synthesis was performed +/– reverse transcription enzyme. Total RNA was transcribed to cDNA using the TaqMan Reverse Transcription Kit (cat. no. N808-0234). Tubes were incubated at 25°C for ten minutes, 48°C for thirty minutes, and 95°C for five minutes. cDNA samples were stored at –20°C until required for analysis.
A reference pool cDNA was generated by mixing 15 µL of each +RT sample, and this reference cDNA was used to generate a standard in the PCR reactions. SYBRgreen mix (Qiagen Quantitect) was used in the Lightcycler PCR. The optimal PCR protocol for measuring the PCR product while minimizing detection of primer dimers was determined empirically on trial runs for the primer pairs. The 5' to 3' primer sequences for dog procollagen (EMBL:AF035120) mRNA were: GGATTCCCTGGACCCAAAGG (forward) and ACCCTGGAAGCCTGGAGGAC (reverse). The 5' to 3' primer sequences for dog β-actin (EMBL: AF021873) mRNA were: TCCGTAAGGACCTGTATGCC (forward) and ACATCTGCTGGAAGGTGGAC (reverse). The melting temperature for both primer pairs was 82°C. Procollagen 1
Three-month Toxicity Study Exposure, Clinical Observations, and Clinical Chemistry There was no obvious difference in Cmax and AUC between male and female dogs. The time for Cmax varied and was typically observed between one and eight hours after dosing. At all dose levels, there was a large inter-individual as well as intra-individual variability in Cmax and AUC (AUC on day 1 and AUC(0–24h) on days 15 and 85). However, based on the geometric mean values at each dose level, the exposure to AR-H047108 increased approximately in proportion to the increase in dose (Table 2).
Dose-related gastrointestinal disturbances were seen during the entire exposure period. Episodic low food consumption was seen among most animals in the high-dose group. Slight to moderate body weight loss was observed during the exposure period in four out of twelve high-dose–treated animals. There was a moderate decrease in the levels of hemoglobin, erythrocytes, and hematocrit in both sexes in the groups given the high dose after three months of dosing. There was also a tendency toward a decrease in these variables in the group given the intermediate dose. A slight decrease was also observed after one month of dosing in both sexes in the high-dose groups. A slight increase in the activated partial thromboplastin time (APTT) values was noted in one male given the intermediate dose and in two females given the high dose (one during the dosing period and one after one month of recovery). Furthermore, after one month of high-dose treatment, a slight increase was noted in the mean activity of aspartate aminotransferase (AST), alanine aminotransferase (ALT), and alkaline phosphatase (ALP), and a slight decrease was noted in the mean plasma concentration of total protein and albumin. After three months of dosing, the changes were more pronounced. A marked decrease in albumin levels was noted after three months in two high-dose females. Partial recovery was noted in most variables after one month without dosing. After three months, full recovery was obtained in both sexes in the APTT values and in the total protein concentration. The red cell variables and the albumin levels were still slightly decreased, and the liver enzyme activities in general slightly increased after the three-month recovery period.
Liver Histopathology and Immunohistochemistry
In one dog, occasional necrotic hepatocytes were observed surrounding occluded, or partially occluded, central veins. Moderate to marked cytoplasmic vacuolar degeneration and ballooning were present in centrilobular hepatocytes in several drug-treated dogs, including recovery animals (Figure 2G). As shown by Oil Red staining, the empty vacuoles contained fat (Figure 2H). Deposition of fibrinogen, von Willebrand factor and tissue factor sometimes occurred around sublobular and central veins, and along centrilobular sinusoids, in the drug-treated dogs (Figure 3B).
There was also an increased staining of TGFβ in the centrilobular area, and a decreased staining of CD14 in the same region (Figures 3D, 3F). This effect was more pronounced in the main study of dogs than in the recovery group, indicating at least partial reversibility. There was only minor, if any, periportal involvement, and bile ducts and ductules were not affected. Centrivenular inflammation, although present, was minimal at the three-month time point. TUNEL staining for detection of apoptotic cells revealed a slight increase in the number of apoptotic hepatocytes in dogs treated with AR-H047108. However, individual variation was large. Other immunohistochemical markers did not show any obvious differences between control dogs and dogs treated with AR-H047108.
Six-month Toxicity Study Two male high-dose animals were preterminally sacrificed after five months of dosing as a result of gradually deteriorated general condition and development of marked ascites. Dose-related gastrointestinal disturbances were seen during the entire exposure period. A gradual deterioration of the general condition, including episodic low food consumption, was seen among animals in the high-dose group. One intermediate- and four high-dose male dogs developed ascites during the last month of dosing. A dose-related decrease in body weight gain was seen in all dose groups, as compared to the control group. After three and six months of dosing, there was a moderate decrease in the mean erythrocyte count, hemoglobin concentration, and hematocrit value in both sexes in the group given the high dose. After six months of dosing, the changes were slightly more pronounced and also noted in males given the intermediate dose. In addition, after six months, an increase in the mean leucocyte, neutrophil, and monocyte count was seen in the high-dose group.
After three and six months of dosing, a slight to moderate decrease in the mean plasma concentration of total protein was noted in males and females given the high dose. The albumin concentration decreased moderately to markedly in both sexes. After six months, a slight decrease in protein concentration and a moderate decrease in albumin were noted in both sexes in the intermediate-dose group, although of statistical significance only in the males. A decrease was also observed in the
Liver Histopathology and Immunohistochemistry
Increased thickness of the smooth muscle layer in sublobular and central veins, congestion, and dilation of sinusoids and lymph vessels were observed in several drug-treated dogs. Scattered necrotic centrilobular hepatocytes occurred in one dog (Figure 4A), and slight centrilobular vacuolar degeneration/ballooning in two dogs. Fat deposition in hepatocytes, as shown by positive Oil Red staining, was present in three of five examined dogs. The periportal and subcapsular regions were more involved at this time point than at three months, with minimal to slight periportal inflammation in three of ten dogs and subcapsular fibrosis in two of ten dogs. Some dogs also showed proliferation of biliary epithelial cells, in the form of a mixed typical/atypical reaction, in the subcapsular areas. Deposition of von Willebrand factor along centrilobular sinusoids was more pronounced at the six-month time point compared to the three-month time point. In one dog, there was also an increased staining for fibrinogen within the centrilobular areas (Figure 4C–D). The effect on TGFβ staining (increase) and CD14 staining (decrease) observed at the three-month time point was not evident at the six-month time point. Other immunohistochemical markers did not show any obvious differences between control dogs and dogs treated with AR-H047108.
One-month Investigative Study Dose-related gastrointestinal disturbances were seen during the entire exposure period. Hematology showed a tendency toward a decrease in hemoglobin, erythrocytes, and hematocrit in treated animals. In the group given the low dose (160 µmol/kg), a transient increase (two- to three-fold) was noted in the plasma activity of ALT after five days of dosing and an approximately two-fold increase after twelve and twenty-six days. There was a large individual variability in the effects on ALT. In the group given the high dose (240 µmol/kg), a three- to six-fold increase in the plasma activity of ALT was observed in two dogs after five days and in one dog after twelve days of treatment. An increase in the plasma activity of ALP was observed at both dose levels after twelve or twenty-six days of dosing. A slight, but consistent, decrease was noted in the plasma concentration of total protein and albumin during the dosing period. The albumin levels were lowest after twenty-six days (80%).
Liver Histopathology and Immunohistochemistry
Profile after Two Weeks The histopathological picture was comparable to the one-week time point (Figure 5B), the only major difference being an increased deposition of von Willebrand factor along the centrilobular sinusoids in all three dogs.
Profile after One Month
Levels of Apolar Retinoids in Liver Samples
Procollagen 1 2 mRNA Levels in Liver SamplesThe levels of procollagen1 2 mRNA were increased from day 8 and throughout the study in dogs treated with the high dose (240 µmol/kg) of AR-H047108 (Figure 7). However, statistical significance (p =.0476) was reached only at the twenty-nine-day time point.
The aim of this study was to investigate and characterize histopathological lesions in the liver of dogs treated with AR-H047108, a proton pump inhibitor acting through a reversible, K+-competitive inhibition of the H+K+-ATPase in the parietal cells. It is unlikely that the primary pharmacological action of proton pump inhibitors is involved in the pathogenesis of this canine hepatotoxicity. In toxicity studies with proton pump inhibitors such as omeprazole and esomeprazole, reversible changes in the gastric mucosa were observed in both dogs and rats (Carlsson et al. 1986; Carlsson 1989). In dogs, the changes are characterized by rugal hypertrophy, hyperplasia of oxyntic mucosal cells, and slight chief cell atrophy. The stomach weights are usually increased. The effects on the gastric mucosa result from the pronounced hypergastrinemia produced as a secondary effect of almost complete inhibition of acid secretion by the large doses of compound used in the toxicity studies (Carlsson et al. 1986). Similar changes in the gastric mucosa are seen in toxicity studies with P-CABs and were also present in dogs treated with AR-H047108 (data not shown). In contrast to the well-documented gastric changes in toxicity studies with proton pump inhibitors, the liver has not been a target organ for toxicity with omeprazole or esomeprazole, neither in dogs nor in other animal species (Ekman et al. 1985). Accordingly, it seems that the hepatotoxicity of AR-H047108 more likely may be related to its chemical structure, that is, a substituted imidazopyridine. There are only a few compounds with imidazopyridine structure currently on the market. Hepatotoxicity of varying degree has been reported for two imidazopyridines that act as anxiolytic drugs, targeting the central benzodiazepine receptor. Alpidem (Ananxyl), which also has a strong affinity for the peripheral benzodiazepine receptor (PBR), was withdrawn in 1995 because of severe hepatotoxicity in humans (Ausset et al. 1995; Baty et al. 1994). The development of ocinaplon, another imidazopyridine anxiolytic drug, was discontinued in 2005 because of an unacceptable rate of liver enzyme elevations in the phase III trial (http://www.dovpharm.com). These data could possibly indicate that the imidazopyridine structure carries a potential for hepatotoxicity. Our findings in dogs treated with AR-H047108 might serve to support this hypothesis. However, the absence of liver lesions in rats and monkeys treated with the same compound could indicate that additional factors are involved, or that the dog liver is more susceptible to certain types of toxic insults. Gastrointestinal disturbances occurred frequently in dogs treated with AR-H047108 and may have contributed to the large inter- and intra-individual variability in Cmax and AUC observed in all three studies. Despite the large variability, the dogs were clearly exposed to the drug and moderate to marked histopathological changes in the liver were present in the vast majority of dogs treated at high doses. Although gastrointestinal disturbances may to some extent have affected a few of the clinical pathology parameters (i.e., albumin and total protein), the clinical pathology picture as a whole (decreased red cell variables and decreased total protein and albumin in combination with increased levels of ALT, AST, and ALP, and a slight increase in APTT) indicates an impaired liver function with a decrease in the synthesis of plasma proteins and damage to hepatocytes. It should be noted that hepatic fibrosis at the six-month time point was of sufficient severity to produce ascites in the majority of male high-dose dogs. Overall, the histopathology of AR-H047108-induced liver toxicity is that of early inflammation (present after one week of dosing) in the central veins and centrilobular areas, paralleled by activation of stellate/Ito cells to myofibroblasts, and associated with sinusoidal and centrivenular fibrosis. At later time points (three and six months), the fibrotic changes predominate, with the addition of increased thickness of the smooth muscle layer in central and sublobular veins. Occlusion of central veins appears at the later time points and seems to include a combination of fibrosis and increased thickness of smooth muscular bundles with a sphincterlike appearance.
Early activation of stellate cells and transformation into collagen-producing myofibroblasts was confirmed by the observed increase in procollagen 1 The observed early activation of hepatic stellate cells in these dogs, together with the venosinusoidal lesion, is reminiscent of so-called veno-occlusive disease (VOD), a toxic lesion involving obstruction of small intrahepatic venules and damage to the surrounding centrilobular hepatocytes and sinusoids (Shulman and Hinterberger 1992). It was originally described in Jamaicans who had consumed local herbal teas containing pyrrolizidine alkaloids. Nowadays, it is seen mainly as a complication following treatment of malignancy and bone marrow transplantation. Pathognomonic features include concentric narrowing or occlusion of terminal hepatic venules and sublobular veins, dilatation and fibrosis of centrilobular sinusoids, and hepatocyte necrosis in zone 3 (Bearman 2000). VOD can be reproduced experimentally in rats and dogs with monocrotaline, a pyrrolizidine alkaloid. In the rat, the initial injury has been localized to the sinusoidal endothelial cells (SECs) through a metabolite of monocrotaline binding to actin in the endothelial cells, which causes a "rounding up" of the SECs, permitting blood to penetrate into the Disse’s spaces (DeLeve et al. 2003). The flow of blood within the Disse’s spaces dissects the sinusoidal lining away from the parenchyma, resulting in an embolism of sinusoidal lining cells that obstructs the microcirculation. There is also an aggregation of monocytes that contributes to the sinusoidal obstruction. Endothelial injury causes activation of the coagulation system, as evidenced by the immunolocalization of fibrinogen and factor VIII/von Willebrand factor in the perivenular zone (DeLeve et al. 2002). Thus it seems that the toxins causing VOD are primarily targeting the SECs rather than the hepatocytes. Direct drug-induced toxicity to hepatocytes is overshadowed by the circulatory disruption caused by the damage to the SECs. The resulting ischemia, perhaps in conjunction with any direct effect on hepatocytes, leads to the ultimate parenchymal dysfunction (DeLeve et al. 1996). If a VOD-like mechanism is responsible for the liver lesions in dogs treated with AR-H047108, the fact that similar lesions are absent in rats and monkeys remains to be explained. At present, available data do not support that differences in metabolism between the various species may be the crucial factor. A more plausible hypothesis might be that the special anatomic features of the dog liver play a role in the pathogenesis of drug-induced liver lesions. The first of these features is the presence of smooth muscle fibers in the sublobular and central liver veins (Arey and Simonds 1920). In the case of the sublobular veins, these muscle fibers act as sphincters, causing vasoconstriction and reduced venous drainage during conditions of experimental shock in dogs (Arey 1941). Smooth muscle sphincters in the sublobular veins are claimed to be unique for the domestic dog and a few other species (raccoons and seals). They are not present in humans, rats, guinea pigs, horses, cats, or rabbits (Arey 1941; Aharinejad et al. 1997). The sublobular venous sphincters could play a crucial role in regulating blood flow in the canine liver. They are reported to contract in response to endothelin-1 (ET-1) as well as to the compound 48/80, a histamine releaser (Aharinejad et al. 1997; Yamamoto 1998). Innervation of sublobular venous sphincters has not been demonstrated, which could suggest that instead, they respond to bloodborne substances or metabolites from nearby tissue (Aharinejad et al. 1997). It has been proposed that the action of ET-1 is a result of binding to ET receptors expressed on the smooth muscle cells (Zhang et al. 1994). In contrast, 48/80 does not stimulate smooth muscle cells directly but instead stimulates degranulation of endothelial cells and mast cells, causing the release of histamine and ET-1 (Yamamoto 1998). Another special feature of the dog liver is the presence of mast cells along the endothelial lining of sublobular and central veins, as well as within the Disse’s spaces (Fujita 1964; Kobayashi et al. 1985). Mast cells in the Disse’s spaces have not been documented in any other vertebrate species than the dog (Kobayashi et al., 1985). Interestingly, the mast cells in the Disse’s spaces of dogs have been found to be in close contact with the stellate (Ito) cells, the primary source of collagen in the liver (Kobayashi et al. 1985). The relationship between mast cells and endothelial cells in the sublobular veins is remarkably close: it is not uncommon to find mast cells that seem to join the endothelial layer itself (Yamamoto 2000). The hepatic mast cells of dogs contain histamine, heparin and ET-1 (Yamamoto 2000). Release of histamine and ET-1 from mast cells in the canine liver is probably an important mechanism for regulation of hepatic blood flow, via constriction of the sublobular venous sphincters. ET-1 has been shown to exert a dual effect on hepatic stellate cells: stimulation of contraction and transformation into activated myofibroblasts (Rockey et al. 1998). Thus, release of ET-1 from mast cells and/or endothelial cells could be an early initiating event triggering the activation of stellate cells in dogs treated with AR-H047108. Taken together, the histopathological findings and the results from immunohistochemical stainings and molecular analyses, as well as the published literature on VOD, are considered to support the following hypothesis for the development of liver lesions in dogs treated with AR-H047108: The compound, or one of its metabolites, exerts a direct toxic effect on SECs, which causes the SECs to release ET-1 and thereby stimulates contraction of smooth muscle venous sphincters and causes congestion of blood in the sinusoids. In addition, ET-1 acts on stellate cells in the Disse’s spaces, causing them to transform into activated myofibroblasts. At the same time, ET-1 stimulates degranulation and release of TGFβ from mast cells in the Disse’s spaces, resulting in further activation of the stellate cells. Once activated, the stellate cells are likely to autonomously promote fibrosis, which is the predominant feature during later stages. These events also lead to disruption of the hepatic microcirculation, resulting in sinusoidal obstruction and secondary damage to centrilobular hepatocytes (fatty degeneration, necrosis). In conclusion, this study provides support for the notion that a VOD-like mechanism involving early activation of stellate cells is responsible for the development of liver toxicity in dogs treated with AR-H047108. The absence of similar lesions in rats and monkeys treated with this compound could imply that the unique morphological features of the dog liver may be of importance in the pathogenesis. This implication could be relevant for humans in a broader sense, and especially highlights the problems in interpreting and translating results of dog toxicity studies where the liver is a target organ.
This version was published on July
1, 2008 Toxicologic Pathology, Vol. 36, No. 5,
727-737 (2008)
|
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
 |
|
|
 |
|
Sign In to gain access to subscriptions and/or personal tools.
TOP
Abstract
Introduction
